Nylon DNA microarray protocols

 

Nylon DNA microarrays are a thumbnail version (of glass-slide format) of the classical Nylon macroarrays^(1-3), allowing a larger target density compatible with pan-genomics approaches. These microarrays have been developed by Konan Peck⁽⁴⁾. They have the advantage of an easy setup in an academic lab at very low cost, to use classical protocols of Molecular Biology, to be reusable, and to use a universal reference. Moreover, they use smaller amounts of samples without any amplification step⁽⁵⁾: typically microarrays can be hybridized with 1 to 5 µg of total RNA. Major drawbacks of this technique are a lower density of spots than other microarrays (a maximum of 15,000 spots on a glass-slide) due to indirect scanning of radioactivity, strong spots overshining, and an independent hybridization of the sample and the reference. Typically, a Nylon microarray measurement consists in one hybridization to measure the spotted amount of targets (hybridization using an oligonucleotide complementary of a vector sequence present in all PCR products), and one hybridization with the RNA sample. Final measurement is the ratio sample/spotted amount. This measurement is necessary due to the dependency of the signal to the spotted amount of target^(5-6). One key point of this technique is to spot a large amount of target to have a good detection⁽⁵⁾. Nylon microarrays can also be used with other types of targets such as short or long oligonucleotides⁽⁷⁾.

• (1) Nguyen C, Rocha D, Granjeaud S, Baldit M, Bernard K, Naquet P, Jordan BR.. Differential gene expression in the murine thymus assayed by quantitative hybridization of arrayed cDNA clones. 1995 Genomics 29: 207–216.
• (2) Zhao, N., Hashida, H., Takahashi, N., Misumi, Y. & Sakaki, Y. High-density cDNA filter analysis: a novel approach for large-scale, quantitative analysis of gene expression. 1995 Gene 156: 207–213.
• (3) Piétu G, Alibert O, Guichard V, Lamy B, Bois F, Leroy E, Mariage-Samson R, Houlgatte R, Soularue P, Auffray C. Novel gene transcripts preferentially expressed in human muscles revealed by quantitative hybridization of a high density cDNA array. 1996 Genome Research  6: 492-503.Chen JJ, Wu R, Yang PC, Huang JY, Sher YP, Han MH, Kao WC, Lee PJ, Chiu TF, Chang F, Chu YW, Wu CW, Peck K. Profiling expression patterns and isolating differentially expressed genes by cDNA microarray system with colorimetry detection. 1998 Genomics. 51: 313-324.
• (4) Bertucci F, Bernard K, Loriod B, Chang YC, Granjeaud S, Birnbaum D, Nguyen C, Peck K, Jordan BR. Sensitivity issues in DNA array-based expression measurements and performance of nylon microarrays for small samples. 1999 Human Molecular Genetics 8: 1715 –1722.
• (5) Stillman BA, Tonkinson JL. Expression microarray hybridizaton kinetics depend on length of the immobilized DNA but are independent of immobilization substrate. 2001 Analytical Biochemistry 295: 149-157.
• (6) El Atifi M, Dupré I, Rostaing B, Chambaz EM, Benabid AL, Berger F. Long oligonucleotide arrays on Nylon for large-scale gene expression analysis. 2002 Biotechniques 33: 612-616.

 

PCR primer design

The cDNAs clones to be arrayed are amplified in 96-well microtiter plates using a PCR amplification. Oligonucleotides allowing amplification of clones from various IMAGE cDNA libraries and hybridizations have been designed. They allow embedded PCR (LBP1A/AS and LBP2A/AS) and the measurement of spotted amounts using an internal primer (LBP3 or LBP9). It is essential that the oligonucleotide used for spotted amount measurement is not one used for PCR amplification, otherwise primer dimers occurring during PCR amplification should be measured at the same time than specific probes and measurement would be wrong.

 

>Lafmid

                                                                                         LBP1S
GTAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAA CATCGCGTTGCGTTAATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTT

         LBP2S                     Hind3                     Not1       EcoR1         LBP9

TTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGCTCGACGGATCCCCTTGCGGCCGCAAGGGGAATTCACTGGCCGTCGTTTTACAACGTCGTGA

AAAGTGTGTCCTTTGTCGATACTGGTACTAATGCGGTTCGAACCGAGCTGCCTAGGGGAACGCCGGCGTTCCCCTTAAGTGACCGGCAGCAAAATGTTGCAGCACT

                                                                                      LBP3

 

CTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGC

GACCCTTTTGGGACCGCAATGGGTTGAATTAGCGGAACGTCGTGTAGGGGGAAAGCGGTCGACCGCATTATCGCTTCTCCGGGCGTGGCTAGCGGGAAGGGTTGTCAACGCG

     LBP2AS             LBP1AS

 

>bluescript

                                                                          LBP1S                      LBP2S TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGAC

ATTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTG

                                                                                                         EcoR1 CATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATA

GTACTAATGCGGTTCGCGCGTTAATTGGGAGTGATTTCCCTTGTTTTCGACCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCTTAAGCTAT

 

                        Xho1                                                             LBP9                                  

TCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTC

AGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGGGTTAAGCGGGATATCACTCAGCATAATGCGCGCGAGTGACCGGCAGCAAAATGTTGCAG

                                                                                         LBP3

 

GTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATC

CACTGACCCTTTTGGGACCGCAATGGGTTGAATTAGCGGAACGTCGTGTAGGGGGAAAGCGGTCGACCGCATTATCGCTTCTCCGGGCGTGGCTAG

          LBP2AS              LBP1AS

 

>PT7T3D

                                                LBP1S                      LBP2S

ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTTAATACGACTCACTATAGGGAATTT

TGGGGTCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCCTTTGTCGATACTGGTACTAATGCTTAAATTATGCTGAGTGATATCCCTTAAA

              EcoR1                            PAC1                                                        LBP9

GGCCCTCGAGGCCAAGAATTCCCGACTACGTAGTCGGGGATCCGTCTTAATTAAGCGGCCGCAAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTG

CCGGGAGCTCCGGTTCTTAAGGGCTGATGCATCAGCCCCTAGGCAGAATTAATTCGCCGGCGTTCGAATAAGGGAAATCACTCCCAATTAAAATCGAACCGTGACCGGCAGCAAAATGTTGCAGCAC

                                                                                                            LBP3

ACTGGGAAAACCCTGGCGTTACCCAAGTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGG

TGACCCTTTTGGGACCGCAATGGGTTGAATTAGCGGAACGTCGTGTAGGGGGAAAGCGGTCGACCGCATTATCGCTTCTCCGGGCGTGGCTAGCGGGAAGGGTTGTCAACGCGTCGGACTTACCGCTTACCC

        LBP2AS              LBP1AS

 

 

PCR amplification

 

Ten microliters of a bacterial suspension in water are added to 90µl of a PCR mix into a 96-well microtiter plate. The amplification is done by:

• 94°C 6'
• 40 cycles (94°C 30'', 55°C 40'', 72°C 1')
• 72°C 10'

One microliter of PCR is deposited on 1% agarose gel. Two hundreds microliters of PCR products are evaporated at 94° in the PCR machine and resuspended in 60µl of water. PCR product concentration should be between 150 to 300 ng/µl. Precise quantification of PCR products (if necessary) can be done directly from the gel. It is not necessary to purify the PCR products. PCR products showing wrong size, 2 bands or week should be discarded. Before spotting, PCR products are transferred from 96-well plates into 384-well plates.

 

 

PCR products spotting

 

Before spotting, pre-cut Nylon membranes (7 x 2 cm², Amersham) are fixed on glass-slides in the robot using a spray glue (ref 3M). Spotting of PCR products in 384-well plates, is done using BioGrid II (Apogent Discoveries) robot. Spot to spot distance is 375 µm, and each PCR product is spotted 4 times for greater amount spotted. Temperature is maintained at 18°C and humidity at 70% during the spotting process. After spotting, filters are transferred (spotted side up) onto a blotting paper saturated with denaturation buffer for 2 times during 10 mn, and on a blotting paper saturated with neutralization buffer for 2 times during 10 mn. Filters are rapidly rinsed with 2xSSC, then dried at 80°C for 2H in a oven, and irradiated with short UV during 1'30''. They are stored during several years before use.

 

Robot	Pins	Membranes	PCR volume used	Spotting Time
MicroGrid II	64 plain pins (100µm diameter)	96	0.2µl (approx.)	5 days

 

 

 

Oligonucleotide hybridization

 

One µg of oligonucleotide (LBP9) is labelled with [g-³³P]ATP (Amersham). One microliter of oligonucleotide (1µg/µl) is added to 24µl of the polynucleotide kinase mix. Incubate 10 mn at 37°C in a oven, then 10mn at 65°C in a waterbath and complete the volume to 100µl. Then purify the probe on a G25 Sephadex column: centrifuge the column for containing 1ml of G25 during 2mn at 2,500 rpm, load 100µl of the kinase reaction on top of the column, centrifuge 4mn at 1,000 rpm, keep eluate, then count radioactivity. Pre-hybridize membranes in the hybridization solution containing 100µg/ml sheared denaturated herring sperm DNA (by heating 10mn at 100°C and quickly cooled on ice) during 4H (10H maximum) at 42°C. Add 50.000 cpm of the labelled oligonucleotide probe and hybridize during 10H at 42°C. Membranes are then washed with the washing solution during 10mn at room temperature, and for 5mn at 42°C with pre-heated solution. Quickly rinse membranes with 2xSSC, and dry them on blotting paper. Expose dry membranes onto a phosphor-imaging plate in a cassette (Raytest/Fuji) for about 8H. Scan with radioimager (FUJI BAS 5000) at 50µm resolution. Strip membranes in the heated deshybridization solution at 75°C in a waterbath during 3H, change solution each hour. Check for stripping by an exposure of 8H on an exposure screen. If some signal remains, try to strip the membranes a second time. Many membranes can be hybridized and washed together. In this case, use larger volumes.

 

 

 

RNA labelling and hybridization

 

Complex probes are prepared from total RNA with an excess of oligo(dT25) to saturate the poly(A) tails of the messengers and to insure that the reverse transcribed product did not contain long poly(T) sequences. Two µg of total RNA, 8µg of dT25, 0,3 ng of spike mRNA (cytochrome c554 from Arabidopsis Thaliana, corresponding to cG03 clones spotted onto microarrays) are mixed in 13µl of DEPC water and incubated during 8mn at 70°C in a water bath to remove secondary structures in the RNA, and progressively cooled to 42°C to insure annealing of oligo(dT) with the poly(A) tail. Add 17µl of RNA labelling mix and incubate at 42°C during 1H, then re-add 1µl of reverse transcriptase, and incubate at 42°C during 1H. RNA was removed by treatment at 68°C for 30mn with 1µl 10% SDS, 1µl 0.5M EDTA and 3µl 3M NaOH, and then equilibrated at room temperature for 15mn. Neutralization was done by adding 10µl 1M Tris-HCl plus 3µl 2N HCl. The probe (after 5 min of denaturation at 100°C) was then incubated with 2µg of poly(dA80) and 2µg of Cot1 DNA in 300µl of hybridization mix during 2H 30mn at 65°C to anneal any possible poly(T) tail left in the probe after initial treatment and repeat sequences.

 

 

RNA sample hybridization

 

Quickly rinse membranes in 2x SSC solution before use. Pre-hybridize them in 2ml of hybridization solution containing 100µg/ml sheared denaturated herring sperm DNA (by heating 10mn at 100°C and quickly cooled on ice) during 6H at 68°C. Replace the solution by the 300µl of hybridization mix that contains the whole labelled probe. Hybridize in a volume of 500µl at 68°C during 48H under agitation. Quickly rinse membranes in the washing solution pre-heated at 68°C, then wash during 3H at 68°C (change solution each hour). Quickly rinse membranes in 2x SSC, and dry them on blotting paper. Expose dry membranes onto a phosphor-imaging plate in a cassette (Raytest/Fuji) for about 24 to 72H. Scan with radioimager (FUJI BAS 5000) at 25µm resolution. Expose dry membranes onto a phosphor-imaging plate in a cassette (Raytest/Fuji) for about 8H. Scan with radioimager (FUJI BAS 5000) at 25µm resolution. Longer re-exposition may be necessary. Strip membranes in the heated deshybridization solution at 85°C in a waterbath during 5H (change solution each hour). Check for stripping by an exposure overnight on an exposure screen. If some signal remains, try to strip the membranes a second time.

 

 

 

Buffer solutions

 

PCR Mix	Denaturation Buffer	Neutralization Buffer	20x SSC
10µl of 10x  PCR buffer 6µl of 25mM MgCl2 2µl of a mix of dNTP 10µM each 1µl of each primer at 100µM 0.5µl of 5U/µl Taq 70.5µl of water	0.5M NaOH 1.5M NaCl	1M Tris-HCl pH7.4 1.5M NaCl	3M NaCl 300mM NaCitrate pH 7.0
50x Denhardt	Hybridization Buffer	Oligonucleotide Labelling Mix	Oligonucleotide Washing Solution
5g Ficoll 400 5g polyvinyl pyrrolidone 5g albumine bovine fraction V H2O qsp 500ml	5x SSC 5x Denhardt 0.5% SDS Filter solution (0.8µm)	5µl of 5x Forward Reaction Buffer 3µl of g33P ATP (5000 Ci/mM) 1µl of T4 polynucleotide Kinase 15µl of water	2x SSC 0.1% SDS
Deshybridization Solution after Oligonucleotide Hybridization	RNA Labelling Mix	RNA Washing Solution	Deshybridization Solution after RNA Hybridization
0.1x SSC 0.1% SDS	1µl RNasin 6µl 5x First Strand Buffer 2µl  0.1M DTT 0.6µl of 20mM (each) dATP dGTP dTTP 0.6µl of 120µM dCTP 3µl of a33P dCTP (>3000 Ci/mM) 1µl Reverse Transcriptase 2.8µl water	0.1x SSC 0.2% SDS	0.5% SDS 1mM EDTA